The Mazanderani people ( Mazanderani : مازرونی مردمون ), also known as the Tabari people or Tabarestani people (Mazanderani: توری مردمون or تبری مردمون ), are an Iranian people who are indigenous to the Caspian Sea region of Iran . They are also referred to as Mazanis for short. They inhabit the southern coast of the Caspian Sea and are part of the historical region known as Tabaristan . The Alborz mountains mark the southern boundary of the area settled by the Mazanderani people.
109-528: The number of Mazanderani was 4,480,000 in 2019. As per a 2006 estimate, the Mazanderani numbered between three and four million. Their dominant religion is Shi'a Islam . Mazandarani people have a background in the Tabari ethnicity, and speak the Tabari language. Their origin goes back to Tapuri people and Amardi people . Their land was called Tapuria or Tapurestan, the land of Tapuris. Most Mazanderanis live on
218-537: A messianic figure , the hidden and last Imam known as "the Mahdi ", that one day shall return on Earth and fill the world with justice. According to the doctrine of Twelver Shīʿīsm , the main goal of Imam Mahdi will be to establish an Islamic state and to apply Islamic laws that were revealed to Muhammad. The Quran does not contain verses on the Imamate, which is the basic doctrine of Shīʿa Islam. Some Shīʿa subsects , such as
327-665: A bomb destroyed the shrine of Al-Askari Mosque. ( See : Anti-Shi'ism ). Shia orthodoxy, particularly in Twelver Shi'ism , has considered non-Muslims as agents of impurity ( Najāsat) . This categorization sometimes extends to kitābῑ , individuals belonging to the People of the Book , with Jews explicitly labeled as impure by certain Shia religious scholars. Armenians in Iran , who have historically played
436-541: A crucial role in the Iranian economy , received relatively more lenient treatment. Shi'ite theologians and mujtahids (jurists), such as Muḥammad Bāqir al-Majlisῑ , held that Jews' impurity extended to the point where they were advised to stay at home on rainy or snowy days to prevent contaminating their Shia neighbors. Ayatollah Khomeini , Supreme Leader of Iran from 1979 to 1989, asserted that every part of an unbeliever's body, including hair, nails, and bodily secretions,
545-584: A number of changes in the Muslim world : With the fall of the Safavids, the state in Iran—including the state system of courts with government-appointed judges ( qāḍī )—became much weaker. This gave the sharīʿa courts of mujtahid an opportunity to fill the legal vacuum and enabled the ulama to assert their judicial authority. The Usuli school of thought also increased in strength at this time. Shia Islam
654-466: A political movement, infallibility and sinlessness of the Imams later evolved as a distinct belief of (non-Zaydī) Shīʿīsm. According to Shīʿa Muslim theologians , infallibility is considered a rational, necessary precondition for spiritual and religious guidance. They argue that since God has commanded absolute obedience from these figures, they must only order that which is right. The state of infallibility
763-660: A sizeable group in so far poorly tested areas east of Turkey. P15 was identified at the University of Arizona and became widely known by 2002. Its chromosome location listed as 21653414. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria , Germany, but G2a subclades were not tested. There are multiple SNPs which so far have the same coverage as P15. They are—with accompanying Y-chromosome locations—U5 (rs2178500), L149 (8486380) and L31 (also called S149) (rs35617575..12538148). Should any man with
872-552: A small number today. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of the Linear Pottery culture , known in German as Linearbandkeramik (LBK), but was not tested for G2a3 subclades. G-M406* (G2a2b1*; previously G2a3a*) and its subclades seem most commonly found in Turkey and the coastal areas of
981-457: A speech at Ghadir Khumm . The point of contention between different Muslim sects arises when Muhammad, whilst giving his speech, gave the proclamation "Anyone who has me as his mawla , has ʿAlī as his mawla ". Some versions add the additional sentence "O God, befriend the friend of ʿAlī and be the enemy of his enemy". Sunnis maintain that Muhammad emphasized the deserving friendship and respect for ʿAlī. In contrast, Shia Muslims assert that
1090-633: A value of 21 at STR marker DYS390. The DYS391 marker has mostly a value of 10, but sometimes 11, in G2a2b1 persons, and DYS392 is almost always 11. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a2b1. G-CTS2488 or G2a2b2 (also known as G-L141.1; previously G-141 and G2a3b) was identified only in mid-2009 at Family Tree DNA . Almost all L141 men belong to L141 subclades. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. L141 persons who do not belong to any L141 subclade so far have
1199-865: Is a human Y-chromosome haplogroup . It is one of two branches of the parent haplogroup GHIJK , the other being HIJK . G-M201 is most commonly found among various ethnic groups of the Caucasus , but is also widely distributed at low frequencies among ethnic groups throughout Europe , West Asia , South Asia , Central Asia , and North Africa . The most commonly occurring subclades are G1* (M285) and many subclades of G2 (G-P287), especially: G2a (P15), G2a1 (G-FGC7535, formerly G-L293), G2a2b2a (G-P303) formerly G2a3b1); G2a2b1 (G-M406) formerly G2a3a; G2a2b2a1 (G-L140) formerly G2a3b1a; G2a2b2a1a1b (G-L497) formerly G2a3b1a2; G2a2b2a1a1a1 (G-L13) formerly G2a3b1a1a; G2a2b2a1a1c1a (G-CTS5990 or G-Z1903) formerly G2a3b1a3; G2b (G-M3115) and; G2b1 (G-M377), formerly G2b. Previously
SECTION 10
#17328512667961308-786: Is a rare group today in Europe. The authors of the Spanish study indicated that the Avellaner men had rare marker values in testing of their short tandem repeat (STR) markers. During the Chalcolithic , haplogroup G was considered ubiquitous in Anatolia, constituting a significant amount of local Y-DNA haplogroups, along with haplogroup J. It remained common throughout the Chalcolithic, Bronze and pre-Roman ages. A 2004 paper found significant correlation between
1417-437: Is a similarity between humans as the little world and the universe as the large world. God does not accept the faith of those who follow him without thinking and only with imitation, but also God blames them for such actions. In other words, humans have to think about the universe with reason and intellect, a faculty bestowed on us by God. Since there is more insistence on the faculty of intellect among Shia Muslims, even evaluating
1526-455: Is already on Earth in Occultation, and will return at the end of time . Ṭayyibi Ismāʿīlīs and Fatimid/Bohra/ Dawoodi Bohra believe the same but for their 21st Ṭayyib, At-Tayyib Abi l-Qasim , and also believe that a Da'i al-Mutlaq ("Unrestricted Missionary") maintains contact with him. Sunnī Muslims believe that the future Mahdi has not yet arrived on Earth. Shīʿa Muslims believe that
1635-569: Is based on the Shīʿīte interpretation of the verse of purification . Thus, they are the most pure ones, the only immaculate ones preserved from, and immune to, all uncleanness. It does not mean that supernatural powers prevent them from committing a sin , but due to the fact that they have absolute belief in God, they refrain from doing anything that is a sin. They also have a complete knowledge of God's will. They are in possession of all knowledge brought by
1744-585: Is commemorated on the Day of Ashura , occurring on the tenth day of Muharram, the first month of the Islamic calendar. Later, most denominations of Shia Islam, including Twelvers and Ismāʿīlīs , became Imamis . Imami Shīʿītes believe that Imams are the spiritual and political successors to Muhammad . Imams are human individuals who not only rule over the Muslim community with justice, but also are able to keep and interpret
1853-671: Is derived from the doctrine of believing in twelve divinely ordained leaders, known as " the Twelve Imams ". Twelver Shia are otherwise known as Imami or Jaʿfari ; the latter term derives from Jaʿfar al-Ṣādiq , the 6th Shīʿīte Imam , who elaborated the Twelver jurisprudence. Twelver Shia constitute the majority of the population in Iran (90%), Azerbaijan (85%), Bahrain (70%), Iraq (65%), and Lebanon (65% of Muslims). Haplogroup G-M201 (Y-DNA)#G2a .28P15.2B.29 Haplogroup G ( M201 )
1962-715: Is described by Iskandar Beg Munshi , the author of the 17th century History of Alam Aray Abbasi . In addition, European travelers such as Chardin and Della Valle have written about their encounters with the Georgian, Circassian and Armenian Mazanderanis. Shiite Shia Islam ( / ˈ ʃ iː ə / ) is the second-largest branch of Islam . It holds that the Islamic prophet Muhammad designated Ali ibn Abi Talib (656–661 CE) as his successor ( Arabic : خليفة , romanized : khalīfa ) as Imam ( امام , 'spiritual and political leader'), most notably at
2071-617: Is followed by 10–15% of all Muslims. Although there are many Shia subsects in the Muslim world, Twelver Shi'ism is by far the largest and most influential, comprising about 85% of all Shia Muslims. Others include the Isma'ili , Zaydi , Alevi and Alawi . Shia Muslims form a majority of the population in three countries across the Muslim world : Iran , Iraq , and Azerbaijan . Significant Shia communities are also found in Lebanon , Kuwait , Turkey , Yemen , Bahrain , Saudi Arabia , Afghanistan and
2180-519: Is found as far east as northern China in small percentages where G can reach more substantial percentages in minority groups such as the Uyghurs. In Turkey, the South Caucasus and Iran , haplogroup G reaches the highest percentage of national populations. Among Turkish males 11% of the population is G. In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. While it
2289-657: Is found at 21327383 and rs35474563 on the Y-chromosome. The forward primer is GTATTGAACTTACAATTCACGTCCC , and the reverse is CTCTCCAAATCGGGTTTCCT . The mutation involves a change from C to T. L223 is found on the Y chromosome at rs13304806. The G-M286 subclade (M286+) is small compared with G-L91. Samples have been identified in England, Germany, Montenegro (Bosniak), Spain, Cyprus (Greek), Turkey, Armenia, Georgia, Lebanon, Syria and Kuwait. The British samples have inconsistent double values for STR marker DYS19 in many cases. M286
SECTION 20
#17328512667962398-471: Is found in almost 25%,. This haplogroup, with the aforementioned J2, accounts for over 50% of the entire sample. Haplogroup G2a3b , attaining significant frequency together with G2a and G1 , is the most commonly carried marker in the G group among Mazanderani men. The lineages E1b1b1a1a-M34 and C5-M356 comprise the remainder, of less than 10% sampled. In the Safavid , Afsharid , and Qajar eras Mazandaran
2507-575: Is found in percentages higher than 10% among the Bakhtiari , Talysh people , Gilaki , Mazandarani and Iranian Azeris , it is closer to 5% among the Iranian Arabs and in some large cities. Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia , 31% from Georgia , 18% from Azerbaijan and 11% from Armenia appear to be G samples. In Europe west of
2616-409: Is high mutual intelligibility among Mazanderani sub-dialects. The dialects of Mazanderani are Saravi, Amoli, Baboli, Ghaemshahri, Chalusi, Nuri, Shahsavari, Ghasrani, Shahmirzadi, Damavandi, Firoozkoohi, Astarabadi and Katouli. The native people of Sari , Qaem Shahr , Babol , Amol , Nowshahr , Chalus , and Tonekabon are Mazanderani people and speak the Mazanderani language. The Mazanderani and
2725-427: Is impure. However, the current leader of Iran, ʿAlī Khameneʾī , stated in a fatwa that Jews and other Peoples of the Book are not inherently impure, and touching the moisture on their hands does not convey impurity. The original Shia identity referred to the followers of Imam ʿAlī, and Shia theology was formulated after the hijra (8th century CE). The first Shia governments and societies were established by
2834-510: Is no god except God, Muhammad is the messenger of God'), but in addition to this declaration of faith Shīʿa Muslims add the phrase Ali-un-Waliullah ( Arabic : علي ولي الله , lit. 'Ali is the guardian of God'). The basis for the Shīʿīte belief in ʿAlī ibn Abī Ṭālib as the Wali of God is derived from the Qur'anic verse 5:55 . This additional phrase to the declaration of faith embodies
2943-474: Is rare. Some ethnic minorities possess it at considerable concentrations, including approximately 18% to 20% of Kalash , approximately 16% of Brahui , and approximately 11.5% of sampled Pashtun , all of whom native to the easternmost regions of the Iranian Plateau , while it only appears in about 3% of the general Pakistani population. In a study of 936 Indians , haplogroup G made up less than 1% of
3052-573: Is reported to have said: "Because you narrate hadith in large numbers from the Holy Prophet, you are fit only for attributing lies to him. (That is, one expects a wicked man like you to utter only lies about the Holy Prophet.) So you must stop narrating hadith from the Prophet; otherwise, I will send you to the land of Dus." (An Arab clan in Yemen , to which Abu Hurairah belonged). According to Sunnī Muslims, ʿAlī
3161-463: Is the second largest branch of Islam . It is estimated that either 10–20% or 10–13% of the global Muslim population are Shias. They may number up to 200 million as of 2009. As of 1985, Shia Muslims are estimated to be 21% of the Muslim population in South Asia , although the total number is difficult to estimate. Shia Muslims form a distinct majority of the population in three countries of
3270-527: Is the concept of infallibility or "divinely bestowed freedom from error and sin" in Islam. Muslims believe that Muhammad, along with the other prophets and messengers , possessed ismah . Twelver and Ismāʿīlī Shīʿa Muslims also attribute the quality to Imams as well as to Fāṭimah , daughter of Muhammad, in contrast to the Zaydī Shīʿas , who do not attribute ismah to the Imams. Though initially beginning as
3379-692: Is the name that whenever the Messenger of God would place it between the Muslims and pagans no arrow from the pagans would reach the Muslims. With him is the similar object that angels brought. Al-Ṣādiq also narrated that the passing down of armaments is synonymous to receiving the Imamat (leadership), similar to how the Ark of Covenant in the house of the Israelites signaled prophethood. Imam Ali al-Ridha narrates that wherever
Mazanderani people - Misplaced Pages Continue
3488-892: The Avellaner cave burial site, near Les Planes d'Hostoles , in Catalonia , Spain and were dated by radiocarbon dating to about 5000 BCE. A skeleton found at the Neolithic cemetery known as Derenburg Meerenstieg II , in Saxony-Anhalt Germany , apparently belonged to G2a3 (G-S126) or a subclade. It was found with burial artifacts belonging to the Linearbandkeramische Kultur (" Linear Band Ceramic Culture "; LBK). This skeleton could not be dated by radiocarbon dating, but other skeletons there were dated to between 5,100 and 6,100 years old. The most detailed SNP mutation identified
3597-582: The Battle of Siffin in 657 turned the tide against ʿAlī, who lost due to arbitration issues with Muawiyah , the governor of Damascus. ʿAlī withdrew to Kufa, overcoming the Kharijis , a faction that had transformed from supporters to bitter rivals, at Nahrawan in 658. In 661, ʿAlī was assassinated by a Khariji assassin in Kufa while in the act of prostration during prayer ( sujud ). Subsequently, Muawiyah asserted his claim to
3706-653: The Black Sea , Haplogroup G is found at about 5% of the population on average throughout most of the continent. The concentration of G falls below this average in Scandinavia , the westernmost former Soviet republics and Poland , as well as in Iceland and the British Isles . There are seeming pockets of unusual concentrations within Europe. In Wales , a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes
3815-588: The Hattian and Kaskian cultures, with the presence of haplogroup G, noting however that higher variances of the G2-P15 subclade exist towards western Anatolia. In Russia, Ukraine and Central Asia , members of various ethnic minorities and/or residents in particular localities possess G-M201 at its highest levels in the world – even though the average rate at the national level is about 1% or less. The Madjar and Argyn tribes (or clans) of Kazakhstan were found to possess
3924-649: The Indian subcontinent . Iran stands as the world's only country where Shia Islam forms the foundation of both its laws and governance system . The word Shia (or Shīʿa) ( / ˈ ʃ iː ə / ) ( Arabic : شيعيّ , romanized : shīʿī, pl. shīʿiyyūn ) is derived from شيعة علي , shīʿat ʿAlī , 'followers of Ali'. Shia Islam is also referred to in English as Shiism (or Shīʿism) ( / ˈ ʃ iː ɪ z ( ə ) m / ), and Shia Muslims as Shiites (or Shīʿites) ( / ˈ ʃ iː aɪ t / ). The term Shia
4033-1135: The Kadhimiya Mosque in Kadhimiya , Al-Askari Mosque in Samarra , the Sahla Mosque , the Great Mosque of Kufa , the Jamkaran Mosque in Qom, and the Tomb of Daniel in Susa . Most of the Shīʿa sacred places and heritage sites in Saudi Arabia have been destroyed by the Al Saud - Wahhabi armies of the Ikhwan , the most notable being the tombs of the Imams located in the Al-Baqi' cemetery in 1925. In 2006,
4142-510: The Middle East , haplogroup G accounts for about 3% of the population in almost all areas. Among the Druze mostly residents of Israel 10% were found to be haplogroup G. Around 10% of Jewish males are Haplogroup G. In Africa , haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. In Egypt , studies have provided information that pegs
4251-506: The Muslim world : Iran , Iraq , and Azerbaijan . Shia Muslims constitute 36.3% of the entire population (and 38.6% of the Muslim population) of the Middle East . Estimates have placed the proportion of Shia Muslims in Lebanon between 27% and 45% of the population, 30–35% of the citizen population in Kuwait (no figures exist for the non-citizen population), over 20% in Turkey , 5–20% of
4360-650: The National Geographic Society placed its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic . Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. Semino et al. (2000) suggested 17,000 years ago. Cinnioglu et al. (2004) suggested the mutation took place only 9,500 years ago. Various estimated dates and locations have been proposed for
4469-418: The Zaydī Shīʿas and Nizārī Ismāʿīlīs , do not believe in the idea of the Occultation. The groups which do believe in it differ as to which lineage of the Imamate is valid, and therefore which individual has gone into Occultation. They believe there are many signs that will indicate the time of his return. Twelver Shīʿa Muslims believe that the prophesied Mahdi and 12th Shīʿīte Imam , Hujjat Allah al-Mahdi ,
Mazanderani people - Misplaced Pages Continue
4578-435: The angels ( Arabic : ملائِكة , romanized : malāʾikah ) to the prophets ( Arabic : أنبياء , romanized : anbiyāʼ ) and the messengers ( Arabic : رُسل , romanized : rusul ). Their knowledge encompasses the totality of all times. Thus, they are believed to act without fault in religious matters. Shi'a Muslims regard ʿAlī ibn Abī Ṭālib as the successor of Muhammad not only ruling over
4687-611: The European Alps. G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia . Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. The L91 mutation
4796-402: The G percentage of the population higher than in England. In the Tirol (Tyrol) of western Austria , the percentage of G-M201 can reach 40% or more; perhaps the most famous example is the ancient remains of the so-called "Iceman", Ötzi . In the northern and highland areas of the island of Sardinia off western Italy , G percentages reach 11% of the population in one study and reached 21% in
4905-511: The G percentage there to be between 2% and 9%. 3% of North African Berbers were found to be haplogroup G. 2% of Arab Moroccans and 0.8% of Berber Moroccans were likewise found to be G. In the Americas , the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. It is not found among Native Americans except where intermarriage with non-native persons has occurred. It has been found in Mexican mestizos. Almost all haplogroup G1 persons have
5014-498: The Gilaki and Mazanderani most closely resemble their geographic and linguistic neighbors, namely other Iranian groups. However, their Y chromosome types most closely resemble those found in groups from the South Caucasus . Researchers have interpreted these differences as demonstrating that peoples from the Caucasus settled in the south Caspian area and mated with peoples from local Iranian groups, possibly because of patrilocality . The Mazanderani and Gilaki groups are closely related on
5123-475: The House'), are rightful rulers or Imams through the bloodline of Ali and his two sons Hasan and Husayn , whom Shia Muslims believe possess special spiritual and political authority over the Muslim community . Later events such as Husayn's martyrdom in the Battle of Karbala (680 CE) further influenced the development of Shia Islam, contributing to the formation of a distinct religious sect with its own rituals and shared collective memory. Shia Islam
5232-446: The Mahdi in his war against the Dajjal, where it is believed the Mahdi will slay the Dajjal and unite humankind. In the century following the Battle of Karbala (680 CE), as various Shia-affiliated groups diffused in the emerging Islamic world, several nations arose based on a Shia leadership or population. A major turning point in the history of Shia Islam was the dominion of the Safavid dynasty (1501–1736) in Persia . This caused
5341-404: The Messenger of Allah. It is not disputable." Further, he claims that with him is the sword of the Messenger of God, his coat of arms, his Lamam (pennon) and his helmet. In addition, he mentions that with him is the flag of the Messenger of God, the victorious. With him is the Staff of Moses , the ring of Solomon , son of David , and the tray on which Moses used to offer his offerings. With him
5450-488: The Middle East where G2a2b2a may have originated. G2a2b2a is also found in India. A majority of members of G-P303 belong to one of its subclades, rather than to G-P303* The largest G-P303* subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. There are additional subclades of DYS388=13 men characterized by
5559-416: The Muslim community. ʿAlī was the first Imam of this line, the rightful successor to Muhammad, followed by male descendants of Muhammad through his daughter Fatimah. This difference between following either the Ahl al-Bayt (Muhammad's family and descendants) or pledging allegiance to Abū Bakr has shaped the Shia–Sunnī divide on the interpretation of some Quranic verses, hadith literature (accounts of
SECTION 50
#17328512667965668-425: The Muslims against Muawiyah and reclaim the caliphate. In 680 CE, Muawiyah died and passed the caliphate to his son Yazid , and breaking the treaty with Ḥasan ibn ʿAlī. Yazid asked Husayn to swear allegiance ( bay'ah ) to him. ʿAlī's faction, having expected the caliphate to return to ʿAlī's line upon Muawiyah's death, saw this as a betrayal of the peace treaty and so Ḥusayn rejected this request for allegiance. There
5777-561: The P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category. Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. They are found only in tiny numbers elsewhere. So far all G2a1 persons have a value of 10 at STR marker DYS392. G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. The North Ossetians in
5886-403: The Quranic verses 3:33 and 3:34 show: "Indeed, Allah chose Adam , Noah , the family of Abraham , and the family of ’Imrân above all people. They are descendants of one another. And Allah is All-Hearing, All-Knowing." Shīʿa Islam encompasses various denominations and subgroups , all bound by the belief that the leader of the Muslim community ( Ummah ) should hail from Ahl al-Bayt ,
5995-417: The SNP have to be examined. Ashkenazi Jewish G2a1a men with northeastern European ancestry form a distinct cluster based on STR marker values. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters. G-PF3147 (previously G-L223 and G-PF3146) is characterized by having the L223 mutation. L223 is found on the Y chromosome at rs810801 and 6405148 with a mutation from C to G. L223
6104-552: The Shīʿīte emphasis on the inheritance of authority through Muhammad's family and lineage . The three clauses of the Shīʿīte version of the Shahada thus address the fundamental Islamic beliefs of Tawḥīd ( Arabic : تَوْحِيد , lit. 'oneness of God'), Nubuwwah ( Arabic : نبوة , lit. 'prophethood'), and Imamah ( Arabic : إمامة , lit. 'Imamate or leadership'). Ismah ( Arabic : عِصْمَة , romanized : 'Iṣmah or 'Isma , lit. 'protection')
6213-413: The Y-DNA SNP definitions used by ISOGG In 2012, several categories found only in one man in research studies were removed from the ISOGG tree causing some renaming.) Ancient G-M201s with sequencing Haplogroup G2a (G-P15) has been identified in Neolithic human remains in Europe dating between 5000 and 3000 BC. These Neolithic Europeans were descendants of Neolithic farmers from Anatolia, among some of
6322-430: The armaments among us would go, knowledge would also follow and the armaments would never depart from those with knowledge ( Imamat ). According to Muhammad Rida al-Muzaffar , God gives humans the faculty of reason and argument. Also, God orders humans to spend time thinking carefully on creation while he refers to all creations as his signs of power and glory. These signs encompass all of the universe. Furthermore, there
6431-555: The caliphate. Upon the death of ʿAlī, his elder son Ḥasan became leader of the Muslims of Kufa. After a series of skirmishes between the Kufa Muslims and the army of Muawiyah, Ḥasan ibn Ali agreed to cede the caliphate to Muawiyah and maintain peace among Muslims upon certain conditions : The enforced public cursing of ʿAlī , e.g. during prayers, should be abandoned; Muawiyah should not use tax money for his own private needs; There should be peace, and followers of Ḥasan should be given security and their rights; Muawiyah will never adopt
6540-442: The claims of someone who claims prophecy is on the basis of intellect. Shia religious practices, such as prayers, differ only slightly from the Sunnīs. While all Muslims pray five times daily, Shia Muslims have the option of combining Dhuhr with Asr and Maghrib with Isha' , as there are three distinct times mentioned in the Quran . The Sunnīs tend to combine only under certain circumstances. Shia Muslims celebrate
6649-500: The closely related Gilaks occupy the south Caspian region of Iran and speak languages belonging to the North-Western branch of Iranian languages . It has been suggested that their ancestors came from the Caucasus region, perhaps displacing an earlier group in the South Caspian. Linguistic evidence supports this scenario, in that the Gilaki and Mazanderani languages (but not other Iranian languages) share certain typological features with Caucasian languages. Based on mtDNA HV1 sequences,
SECTION 60
#17328512667966758-501: The colonial period, such as the Khoja . Figures indicated in the first three columns below are based on the October 2009 demographic study by the Pew Research Center report, Mapping the Global Muslim Population . The Shia community throughout its history split over the issue of the Imamate. The largest branch are the Twelvers , followed by the Zaydīs and the Ismāʿīlīs . Each subsect of Shīʿīsm follows its own line of Imamate. All mainstream Twelver and Ismāʿīlī Shia Muslims follow
6867-418: The divine guide, is a fundamental belief in the Twelver and Ismāʿīlī branches of Shia Islam, and is based on the concept that God would not leave humanity without access to divine guidance. In Shia Islam, Imam Mahdi is regarded as the prophesied eschatological redeemer of Islam who will rule for seven, nine, or nineteen years (according to differing interpretations) before the Day of Judgment and will rid
6976-415: The divine law and its esoteric meaning . The words and deeds of Muhammad and the Imams are a guide and model for the community to follow; as a result, they must be free from error and sin, and must be chosen by divine decree ( nass ) through Muhammad. According to this view peculiar to Shia Islam, there is always an Imam of the Age, who is the divinely appointed authority on all matters of faith and law in
7085-453: The earliest peoples in the world to practice agriculture. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE. Furthermore, the majority of all the male skeletons from the European Neolithic period have so far yielded Y-DNA belonging to this haplogroup. The oldest skeletons confirmed by ancient DNA testing as carrying haplogroup G2a were five found in
7194-472: The eastern Mediterranean where it can constitute up to 5% of all makes and 50% of haplogroup G samples. G2a2b1 is more common in southern Europe than northern Europe. In Europe—except in Italy – G2a2b1 constitutes less than 20% of G samples. G2a2b1 so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran . A relatively high percentage of G2a2b1 persons have
7303-408: The end of the 9th century CE. The 10th century CE has been referred to by the scholar of Islamic studies Louis Massignon as "the Shiite Ismaili century in the history of Islam". The Shia, originally known as the "partisans" of ʿAlī ibn Abī Ṭālib , Muhammad's cousin and Fatima 's husband, first emerged as a distinct movement during the First Fitna from 656 to 661 CE. Shia doctrine holds that ʿAlī
7412-401: The entire Muslim community in justice, but also in interpreting the Islamic faith, practices, and its esoteric meaning. ʿAlī is regarded as a " perfect man " ( Arabic : الإنسان الكامل , romanized : al-insan al-kamil ) similar to Muhammad, according to the Shīʿīte perspective. The Occultation is an eschatological belief held in various denominations of Shīʿa Islam concerning
7521-402: The event of Ghadir Khumm , but that after Muhammad's death, Ali was prevented from succeeding as leader of the Muslims as a result of the choice made by some of Muhammad's other companions ( صحابة , ṣaḥāba ) at Saqifah . This view primarily contrasts with that of Sunni Islam , whose adherents believe that Muhammad did not appoint a successor before his death and consider Abu Bakr , who
7630-642: The family of the Islamic prophet Muhammad . It embodies a completely independent system of religious interpretation and political authority in the Muslim world . Shīʿa Muslims believe that just as a prophet is appointed by God alone, only God has the prerogative to appoint the successor to his prophet. They believe God chose ʿAlī ibn Abī Ṭālib to be Muhammad's successor and the first caliph ( Arabic : خليفة , romanized : khalifa ) of Islam. Shīʿa Muslims believe that Muhammad designated Ali as his successor by God's command on several instances, but most notably at Eid Al Ghadir . Additionally, ʿAlī
7739-435: The following annual holidays: After Mecca and Medina , the two holiest cities of Islam , the cities of Najaf , Karbala , Mashhad and Qom are the most revered by Shīʿa Muslims. The Sanctuary of Imām ʿAlī in Najaf, the Shrine of Imam Ḥusayn in Karbala, The Sanctuary of Imam Reza in Mashhad and the Shrine of Fāṭimah al-Maʿṣūmah in Qom are very essential for Shīʿa Muslims. Other venerated pilgrimage sites include
7848-450: The growth of education and the media, the distinction between Mazanderani and other Iranian languages is likely to disappear. Mazanderani is closely related to Gilaki and the two languages have similar vocabularies. They preserve more of the noun declension system characteristic of older Iranian languages than Persian does. Assistant professor Maryam Borjian of Rutgers University states that Mazanderani has different sub-dialects and there
7957-549: The hadith attributed to the Ahl al-Bayt and close associates, and most have their own separate hadith canon . Shīʿa Muslims believe that the armaments and sacred items of all of the Abrahamic prophets , including Muhammad , were handed down in succession to the Imams of the Ahl al-Bayt . Jaʿfar al-Ṣādiq , the 6th Shīʿīte Imam , in Kitab al-Kafi mentions that "with me are the arms of
8066-650: The highest levels of G-M201 among any modern ethnic group. Amongst the Madjars, G1 was found at a rate of 87%. A separate study on the Argyns found that 71% of males belong to G1. In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. Digora , North Ossetia has the highest known concentration of G in a single city, as 74% of the tested men were G. Haplogroup G
8175-817: The island during the time of the Spanish Inquisition , of which a significant portion are identifiable as G-Z725 (DYS388=13). G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. The SNP L177 (a.k.a. L1771.1/ L177_1, L1771.2/L177_2, L177.3/L177_3) was withdrawn as an identifier by ISOGG in 2013, after it was "found to be an unreliable palindromic snp". Ancient DNA identified as G-PF3359 has been found at archaeological sites in: Hungary (the subclade G-F872*), dated at 7,500 years before present (BP); Hungary (subclade G-F1193*) 7,150 BP, and; Spain (G-PF3359*) 4,700 BP. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only
8284-456: The leaders of Medina and elected Abū Bakr as the first rāshidūn caliph. Abū Bakr served from 632 to 634, and was followed by Umar (634–644) and ʿUthmān (644–656). With the murder of ʿUthmān in 657 CE, the Muslims of Medina invited ʿAlī to become the fourth caliph as the last source, and he established his capital in Kufa . ʿAlī's rule over the early Islamic empire , between 656 CE to 661 CE,
8393-687: The male side with populations from the South Caucasus such as Georgians , Armenians , and Azerbaijanis . Analysis of their NRY patrilines has revealed haplogroup J2 , associated with the neolithic diffusion of agriculturalists from the Near East , to be the predominant Y-DNA lineage among the Mazanderani (subclades J2a3h-M530, J2a3b-M67 and J2a-M410, more specifically.). The next most frequently occurring lineage, R1a1a , believed to have been associated with early Iranian expansion into Central / Southern Eurasia and currently ubiquitous in that area,
8502-544: The mid northern Caucasus area of Russia belong overwhelmingly to the G2a1 subclade based on available samples. The South Ossetians and Svans generally south of North Ossetia have significant number of G2a1 persons, but population percentages have not yet been provided. The presence of the SNP P18 mutation characterizes G2a1a's only subclade, G2a1a. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of
8611-606: The origin of G-M201, most of them in Western Asia . A more eastern origin has also been mentioned, believed by some to originate in an area of the Middle East close to the Himalayan foothills. Nevertheless, in line with the highest diversity of basal branches, a paper by Siiri Rootsi et al. suggested that: "We estimate that the geographic origin of haplogroup G plausibly locates somewhere nearby eastern Anatolia , Armenia or western Iran ." G* (M201) (Subclades here conform to
8720-693: The population in Pakistan , and 10–19% of Afghanistan 's population, and 45% in Bahrain . Saudi Arabia hosts a number of distinct Shia communities, including the Twelver Baharna in the Eastern Province and Nakhawila of Medina, and the Ismāʿīlī Sulaymani and Zaydī Shias of Najran . Estimations put the number of Shīʿīte citizens at roughly 15% of the local population. Approximately 40% of
8829-786: The population of Yemen are Shia Muslims. Significant Shia communities also exist in the coastal regions of West Sumatra and Aceh in Indonesia (see Tabuik ). The Shia presence is negligible elsewhere in Southeast Asia, where Muslims are predominantly Shāfiʿī Sunnīs. A significant Shia minority is present in Nigeria , made up of modern-era converts to a Shīʿīte movement centered around Kano and Sokoto states. Several African countries like Kenya , South Africa , Somalia , etc. hold small minority populations of various Shia subsects, primarily descendants of immigrants from South Asia during
8938-505: The presence of specific SNPs or uncommon STR marker oddities. Members of this group have been found in Europe and the Middle East . The next largest subclade of G-P303 is characterized by the presence of the U1 mutation. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). The G-L13 subclade is most common in north central Europe, and G-Z1266 is most common in
9047-593: The same school of thought, the Jaʽfari jurisprudence , named after Jaʿfar al-Ṣādiq , the 6th Shīʿīte Imam . Shīʿīte clergymen and jurists usually carry the title of mujtahid (i.e., someone authorized to issue legal opinions in Shia Islam). Twelver Shīʿīsm or Ithnāʿashariyyah is the largest branch of Shia Islam, and the terms Shia Muslim and Shia often refer to the Twelvers by default. The designation Twelver
9156-697: The sample and was completely absent in the tested north-western Indian population. In one study, about 6% of the samples from Sri Lanka and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean or Pacific Ocean in Asia. G-M201 has been described as "almost absent" and "virtually absent" in India, with the G2a-P15 subclade in particular being considered to be negligible, indicating unique dispersal events from Western Asia. In
9265-692: The sayings and living habits attributed to the Islamic prophet Muhammad during his lifetime), and other areas of Islamic belief throughout the history of Islam . For instance, the hadith collections venerated by Shia Muslims are centered on narrations by members of the Ahl al-Bayt and their supporters, while some hadith transmitted by narrators not belonging to or supporting the Ahl al-Bayt are not included. Those of Abu Hurairah , for example, Ibn Asakir in his Taʿrikh Kabir , and Muttaqi in his Kanzuʿl-Umma report that ʿUmar ibn al-Khaṭṭāb lashed him, rebuked him, and forbade him to narrate ḥadīth from Muhammad. ʿUmar
9374-716: The southeastern coast of the Caspian Sea . Their traditional professions are farming and fishing. The Mazanderanis are closely related to the neighbouring Gilaki people as well as South Caucasian peoples (e.g., the Georgians , Armenians , and Azerbaijanis ). The Mazanderani language is a Northwestern Iranian language spoken by the Mazanderani people; however, most Mazanderanis are also fluent in Persian . The Gilaki and Mazanderani languages (but not other Iranian languages) share certain typological features with Caucasian languages . With
9483-496: The statement unequivocally designates ʿAlī as Muhammad's appointed successor. Shia sources also record further details of the event, such as stating that those present congratulated ʿAlī and acclaimed him as Amir al-Mu'minin ("commander of the believers"). When Muhammad died in 632 CE, ʿAlī ibn Abī Ṭālib and Muhammad's closest relatives made the funeral arrangements. While they were preparing his body, Abū Bakr , ʿUmar ibn al-Khaṭṭāb , and Abu Ubaidah ibn al Jarrah met with
9592-609: The status of ʿAlī is supported by numerous ḥadīth reports , including the Hadith of the pond of Khumm , Hadith of the two weighty things , Hadith of the pen and paper , Hadith of the invitation of the close families , and Hadith of the Twelve Successors . In particular, the Hadith of the Cloak is often quoted to illustrate Muhammad's feeling towards ʿAlī and his family by both Sunnī and Shia scholars. Shia Muslims prefer to study and read
9701-446: The term Shia refers to those who believe that ʿAlī is designated as the heir , Imam, and caliph by Muhammad and that ʿAlī's authority is maintained through his descendants. For the adherents of Shia Islam, this conviction is implicit in the Quran and the history of Islam . Shia Muslim scholars emphasize that the notion of authority is linked to the family of the Abrahamic prophets as
9810-434: The title of Amir al-Mu'minin ("commander of the believers"); Muawiyah will not nominate any successor. Ḥasan then retired to Medina , where in 670 CE he was poisoned by his wife Ja'da bint al-Ash'ath , after being secretly contacted by Muawiyah who wished to pass the caliphate to his own son Yazid and saw Ḥasan as an obstacle. Ḥusayn ibn ʿAlī , ʿAlī's younger son and brother to Ḥasan, initially resisted calls to lead
9919-676: The town of Tempio in another study. In the Greek island of Crete , approximately 7% to 11% of males belong to haplogroup G. In north-eastern Croatia , in the town of Osijek , G was found in 14% of the males. The city is on the banks of the river Drava , which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been found to belong to Haplogroup G. In South Asia , haplogroup G
10028-435: The value of 11 at STR marker DYS490 — a finding rare in other G categories. The L141 mutation is found on the Y chromosome at 2948607. The L141 mutation involves an insertion. G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus , as well as, at lower levels, other parts of Europe and South West Asia , especially an area including Turkey, Iran and
10137-454: The value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. This value of 12 is uncommon in other G categories other than G1. subclades of G1a, G1a1, G1b exist. The highest reported concentration of G1 and its subclades in a single country is in Iran , with next most frequent concentrations in neighboring countries to
10246-515: The west. There are distinctive Ashkenazi Jewish and Kazakh subclades based on STR marker value combinations. Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. P287 was identified at the University of Arizona and became widely known in late 2007. Its identification caused considerable renaming of G categories. Haplogroup G men who belong to this group, but are negative for all G2a subclades, are uncommon in Europe but may represent
10355-537: The western Caucasus Mountains. The final major subclade is characterized by presence of the SNP Z1903 and by a value of 9 at marker DYS568. A high percentage of G-Z1903 men belong to its subclade, G-Z724. The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. This group has been linked with the Crypto-Jewish population which fled to
10464-573: The world of evil. According to Islamic tradition, the Mahdi's tenure will coincide with the Second Coming of Jesus (ʿĪsā), who is to assist the Mahdi against the Masih ad-Dajjal (literally, the "false Messiah" or Antichrist). Jesus, who is considered the Masih (" Messiah ") in Islam, will descend at the point of a white arcade east of Damascus , dressed in yellow robes with his head anointed. He will then join
10573-588: Was Muhammad's first-cousin and closest living male relative as well as his son-in-law, having married Muhammad's daughter, Fāṭimah . The Shīʿīte version of the Shahada ( Arabic : الشهادة ), the Islamic profession of faith, differs from that of the Sunnīs . The Sunnī version of the Shahada states La ilaha illallah, Muhammadun rasulullah ( Arabic : لَا إِلٰهَ إِلَّا الله مُحَمَّدٌ رَسُولُ الله , lit. 'There
10682-540: Was S126 (L30), which defines G2a3. G2a was found also in 20 out of 22 samples of ancient Y-DNA from Treilles , the type-site of a Late Neolithic group of farmers in the Southern France , dated to about 5000 years ago. The fourth site also from the same period is the Ötztal Alps where the mummified remains of Ötzi the Iceman were discovered. The Iceman belongs to haplogroup G2a2b (earlier called G2a4). Haplogroup G2a2b
10791-537: Was a groundswell of support in Kufa for Ḥusayn to return there and take his position as caliph and Imam, so Ḥusayn collected his family and followers in Medina and set off for Kufa. En route to Kufa, Husayn was blocked by an army of Yazid's men, which included people from Kufa, near Karbala ; rather than surrendering, Husayn and his followers chose to fight. In the Battle of Karbala , Ḥusayn and approximately 72 of his family members and followers were killed, and Husayn's head
10900-417: Was appointed caliph by a group of Muhammad's other companions at Saqifah, to be the first Rashidun ('rightful') caliph after Muhammad (632–634 CE). Shia Muslims' belief that Ali was the designated successor to Muhammad as Islam's spiritual and political leader later developed into the concept of Imamah , the idea that certain descendants of Muhammad, the Ahl al-Bayt ( أَهْل البَيْت , 'People of
11009-481: Was delivered to Yazid in Damascus. The Shi'a community regard Ḥusayn ibn ʿAlī as a martyr ( shahid ), and count him as an Imam from the Ahl al-Bayt . The Battle of Karbala and martyrdom of Ḥusayn ibn ʿAlī is often cited as the definitive separation between the Shia and Sunnī sects of Islam . Ḥusayn is the last Imam following ʿAlī mutually recognized by all branches of Shia Islam. The martyrdom of Husayn and his followers
11118-640: Was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A. The L293 SNP that characterizes a third subclade was identified in June 2010 at Family Tree DNA. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. The mutation is found on the Y chromosome at 10595022 and is a change from G to C. G-L30 (also G-PF3267, G-S126 or G-U8; G2a2b, previously G2a3) Men who belong to this group but are negative for all its subclades represent
11227-404: Was first identified in samples at 23andMe in 2009 but proved problematic as an individual test, the first successful results being reported at Family Tree DNA in late 2011 under its assigned L223 label. It was then learned that several subclades belong under L223, including: G-L91 was identified in 2009. Its members include " Ötzi ", the so-called Iceman, who died at least 5,000 years BP in
11336-478: Was first used during Muhammad's lifetime. At present, the word refers to the Muslims who believe that the leadership of the Muslim community after Muhammad belongs to ʿAlī ibn Abī Ṭālib , Muhammad's cousin and son-in-law, and his successors. Nawbakhti states that the term Shia refers to a group of Muslims who at the time of Muhammad and after him regarded ʿAlī as the Imam and caliph . Al-Shahrastani expresses that
11445-463: Was meant to lead the community after Muhammad's death in 632. Historians dispute over the origins of Shia Islam , with many Western scholars positing that Shīʿīsm began as a political faction rather than a truly religious movement. Other scholars disagree, considering this concept of religious-political separation to be an anachronistic application of a Western concept. Shia Muslims believe that Muhammad designated ʿAlī ibn Abī Ṭālib as his heir during
11554-574: Was often contested. Tensions eventually led to the First Fitna , the first major civil war between Muslims within the empire, which began as a series of revolts fought against ʿAlī. While the rebels had previously affirmed the legitimacy of ʿAlī's khilafāʾ (caliphate), they later turned against ʿAlī and fought him. Tensions escalated into the Battle of the Camel in 656, where Ali's forces emerged victorious against Aisha , Talhah , and al-Zubayr . However,
11663-560: Was settled by large numbers of Georgians , Armenians and other peoples of the Caucasus , whose descendants still live across Mazandaran. The names of many towns, villages and neighbourhoods in Mazandaran reflect this legacy by bearing variations of the name "Gorji" (i.e., Georgian), although most of the Georgians are assimilated into the mainstream Mazanderanis. The history of Georgian settlement
11772-446: Was the fourth successor to Abū Bakr, while Shia Muslims maintain that ʿAlī was the first divinely sanctioned "Imam", or successor of Muhammad. The seminal event in Shia history is the martyrdom at the Battle of Karbala of ʿAlī's son, Ḥusayn ibn ʿAlī , and 71 of his followers in 680 CE, who led a non-allegiance movement against the defiant caliph. It is believed in Twelver and Ismāʿīlī branches of Shia Islam that divine wisdom ( ʿaql )
11881-446: Was the source of the souls of the prophets and Imams, which bestowed upon them esoteric knowledge ( ḥikmah ), and that their sufferings were a means of divine grace to their devotees. Although the Imam was not the recipient of a divine revelation ( waḥy ), he had a close relationship with God , through which God guides him, and the Imam, in turn, guides the people. Imamate , or belief in
#795204